<!--

COPYRIGHT NOTICE

This file is part of the "Universal Biomedical Skills" project.

Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>

All Rights Reserved.

#

This code is proprietary and confidential.

Unauthorized copying of this file, via any medium is strictly prohibited.

#

Provenance: Authenticated by MD BABU MIA

-->

Codon Usage

Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.

Required Imports

python
from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter

Basic Codon Counting

Count Codons in Sequence

python
from collections import Counter

def count_codons(seq):
    seq_str = str(seq).upper()
    codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
    return Counter(codons)

seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)

Codon Frequencies (Relative)

python
def codon_frequencies(seq):
    counts = count_codons(seq)
    total = sum(counts.values())
    return {codon: count / total for codon, count in counts.items()}

Codon Adaptation Index (CAI)

Using CodonUsage Module

python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

# Create CAI calculator with reference set
cai = CodonAdaptationIndex()

# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')

# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}')  # Range 0-1, higher = better adapted

CAI with Custom Codon Index

python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

cai = CodonAdaptationIndex()

# Set custom index (relative adaptiveness for each codon)
custom_index = {
    'TTT': 0.5, 'TTC': 1.0,  # Phe
    'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0,  # Leu
    # ... define all 64 codons
}
cai.set_cai_index(custom_index)

Synonymous Codon Usage

RSCU (Relative Synonymous Codon Usage)

RSCU = (observed codon frequency) / (expected frequency if all synonymous codons were used equally)

python
from Bio.Data import CodonTable

def calculate_rscu(seq, table_id=1):
    codon_table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)

    # Group codons by amino acid
    aa_to_codons = {}
    for codon in counts:
        if codon in codon_table.stop_codons:
            continue
        try:
            aa = codon_table.forward_table[codon]
            aa_to_codons.setdefault(aa, []).append(codon)
        except KeyError:
            continue

    # Calculate RSCU for each codon
    rscu = {}
    for aa, codons in aa_to_codons.items():
        total = sum(counts.get(c, 0) for c in codons)
        n_synonymous = len(codons)
        expected = total / n_synonymous if n_synonymous > 0 else 0
        for codon in codons:
            observed = counts.get(codon, 0)
            rscu[codon] = observed / expected if expected > 0 else 0
    return rscu

Identify Rare Codons

python
def find_rare_codons(seq, threshold=0.1):
    freq = codon_frequencies(seq)
    return {codon: f for codon, f in freq.items() if f < threshold}

Codon Bias by Position (GC123)

python
from Bio.SeqUtils import GC123

seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)

print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')

Codon Tables

Access Codon Tables

python
from Bio.Data import CodonTable

# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]

# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
    print(f'{id}: {table.names[0]}')

Common Codon Tables

| ID | Name | Organism | |----|------|----------| | 1 | Standard | Most organisms | | 2 | Vertebrate Mitochondrial | Human, mouse mito | | 4 | Mold Mitochondrial | Fungi, protozoa mito | | 5 | Invertebrate Mitochondrial | Insects, worms mito | | 11 | Bacterial/Plastid | E. coli, chloroplasts |

Codon Table Properties

python
table = CodonTable.unambiguous_dna_by_id[1]

print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')

# Forward table: codon -> amino acid
print(table.forward_table['ATG'])  # 'M'

# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
    back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')

Code Patterns

Full Codon Usage Report

python
def codon_usage_report(seq, table_id=1):
    from Bio.Data import CodonTable

    table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)
    total = sum(counts.values())

    # Group by amino acid
    aa_groups = {}
    for codon, aa in table.forward_table.items():
        aa_groups.setdefault(aa, []).append(codon)

    report = {}
    for aa, codons in sorted(aa_groups.items()):
        aa_total = sum(counts.get(c, 0) for c in codons)
        report[aa] = {
            'total': aa_total,
            'codons': {c: {'count': counts.get(c, 0),
                          'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
                      for c in codons}
        }
    return report

Compare Codon Usage Between Sequences

python
def compare_codon_usage(seq1, seq2):
    freq1 = codon_frequencies(seq1)
    freq2 = codon_frequencies(seq2)

    all_codons = set(freq1.keys()) | set(freq2.keys())
    comparison = {}
    for codon in sorted(all_codons):
        f1, f2 = freq1.get(codon, 0), freq2.get(codon, 0)
        comparison[codon] = {'seq1': f1, 'seq2': f2, 'diff': f1 - f2}
    return comparison

Optimize Codons for Expression

python
def optimize_codons(protein_seq, preferred_codons):
    '''Replace codons with preferred synonymous codons'''
    optimized = []
    for aa in str(protein_seq):
        if aa in preferred_codons:
            optimized.append(preferred_codons[aa])
        else:
            optimized.append('NNN')  # Unknown
    return Seq(''.join(optimized))

# E. coli preferred codons
ecoli_preferred = {
    'A': 'GCG', 'R': 'CGT', 'N': 'AAC', 'D': 'GAT', 'C': 'TGC',
    'Q': 'CAG', 'E': 'GAA', 'G': 'GGT', 'H': 'CAC', 'I': 'ATT',
    'L': 'CTG', 'K': 'AAA', 'M': 'ATG', 'F': 'TTC', 'P': 'CCG',
    'S': 'TCT', 'T': 'ACC', 'W': 'TGG', 'Y': 'TAC', 'V': 'GTT',
}

Codon Usage from FASTA File

python
from Bio import SeqIO

def analyze_fasta_codon_usage(filename):
    all_counts = Counter()
    for record in SeqIO.parse(filename, 'fasta'):
        all_counts.update(count_codons(record.seq))

    total = sum(all_counts.values())
    return {codon: count / total for codon, count in all_counts.items()}

Effective Number of Codons (Nc)

A measure of codon bias (lower = more biased, range 20-61):

python
import math

def effective_nc(seq, table_id=1):
    from Bio.Data import CodonTable
    table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)

    # Group by degeneracy class
    aa_groups = {}
    for codon, aa in table.forward_table.items():
        aa_groups.setdefault(aa, []).append(codon)

    # Calculate F for each amino acid
    nc_sum = 0
    for aa, codons in aa_groups.items():
        n = sum(counts.get(c, 0) for c in codons)
        if n <= 1:
            continue
        pi_sq_sum = sum((counts.get(c, 0) / n) ** 2 for c in codons)
        F = (n * pi_sq_sum - 1) / (n - 1)
        nc_sum += 1 / F if F > 0 else len(codons)

    return nc_sum if nc_sum > 0 else 61

Property Reference

| Metric | Range | Interpretation | |--------|-------|----------------| | CAI | 0-1 | Higher = better adapted to host | | RSCU | 0-N | 1.0 = no bias, >1 = overused, <1 = underused | | Nc | 20-61 | Lower = more biased | | GC3 | 0-100% | GC at wobble position |

Common Errors

| Error | Cause | Solution | |-------|-------|----------| | KeyError | Non-standard codon | Handle N-containing codons | | Wrong counts | Sequence not in frame | Ensure length is multiple of 3 | | No index set | Called CAI without training | Call generate_index() first |

Decision Tree

Need to analyze codon usage?
├── Count codon frequencies?
│   └── Use Counter on 3-mers
├── Calculate adaptation to host?
│   └── Use CodonAdaptationIndex (CAI)
├── Identify synonymous bias?
│   └── Calculate RSCU
├── Check wobble position bias?
│   └── Use GC123()
├── Measure overall bias?
│   └── Calculate Nc (effective number of codons)
└── Optimize for expression?
    └── Replace with preferred synonymous codons

Related Skills

• transcription-translation - Translate sequences and understand codon tables
• sequence-properties - GC123 for wobble position GC content
• sequence-io/read-sequences - Parse CDS sequences from GenBank files
• database-access/entrez-fetch - Fetch reference gene sets from NCBI for CAI training

<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->