Loading skill
Install any skill in seconds. Free to start, no credit card required.
Get Started Free →Fast miRNA quantification with isomiR detection and A-to-I editing analysis using miRge3. Use when quantifying known miRNAs quickly or analyzing isomiR variants and RNA editing.
| Test case | Without → With | Effect | Δ tokens | Δ turns |
|---|---|---|---|---|
| case-13 | ✗→✓ | ▲ Improved | 34% | 0% |
| case-14 | ✗→✓ | ▲ Improved | 11% | 0% |
| case-01 | ✗→✓ | ▲ Improved | 33% | 0% |
| case-03 | ✗→✓ | ▲ Improved | 13% | 0% |
| case-04 | ✗→✓ | ▲ Improved | 10% | 0% |
<!--
#
#
-->
bash# Run miRge3 on FASTQ files miRge3.0 annotate \ -s sample1.fastq.gz,sample2.fastq.gz \ -lib miRge3_libs \ -on human \ -db mirbase \ -o output_dir \ -a TGGAATTCTCGGGTGCCAAGG \ --threads 8 # Key options: # -s: Input FASTQ files (comma-separated) # -lib: Path to miRge3 library # -on: Organism name # -db: Database (mirbase or mirgenedb) # -a: 3' adapter sequence
bash# Download pre-built libraries miRge3.0 --download-library human mirbase # Libraries include: # - Bowtie indices for miRNAs, tRNAs, rRNAs # - miRBase or MirGeneDB annotations # - A-to-I editing sites
bash# Enable isomiR analysis miRge3.0 annotate \ -s sample.fastq.gz \ -lib miRge3_libs \ -on human \ -db mirbase \ --isomir \ -o output_dir # IsomiRs include: # - 5' variants (templated and non-templated) # - 3' variants (templated and non-templated) # - Internal modifications
bash# Detect A-to-I editing miRge3.0 annotate \ -s sample.fastq.gz \ -lib miRge3_libs \ -on human \ -db mirbase \ --AtoI \ -o output_dir # Outputs editing sites and frequencies
| File | Description | |------|-------------| | miR.Counts.csv | Raw read counts per miRNA | | miR.RPM.csv | RPM normalized counts | | isomiR.Counts.csv | IsomiR-level counts | | isomiR.summary.csv | IsomiR summary per miRNA | | annotation.report.html | Interactive QC report |
pythonfrom mirge3.annotate import annotate # Run programmatically annotate( samples=['sample1.fastq.gz', 'sample2.fastq.gz'], lib_path='miRge3_libs', organism='human', database='mirbase', adapter='TGGAATTCTCGGGTGCCAAGG', output_dir='results', threads=8 )
pythonimport pandas as pd def load_mirge3_counts(output_dir): '''Load miRge3 count matrix''' counts = pd.read_csv(f'{output_dir}/miR.Counts.csv', index_col=0) return counts def load_isomirs(output_dir): '''Load isomiR-level counts''' isomirs = pd.read_csv(f'{output_dir}/isomiR.Counts.csv', index_col=0) return isomirs # Filter low-expressed miRNAs def filter_low_counts(counts, min_total=10): '''Keep miRNAs with total count >= threshold''' return counts[counts.sum(axis=1) >= min_total]
pythondef normalize_rpm(counts): '''Normalize to reads per million''' total_per_sample = counts.sum(axis=0) rpm = counts / total_per_sample * 1e6 return rpm def log_transform(rpm, pseudocount=1): '''Log2 transform with pseudocount''' import numpy as np return np.log2(rpm + pseudocount)
pythondef summarize_isomirs(isomir_counts): '''Summarize isomiR diversity per miRNA''' # Group by canonical miRNA isomir_counts['miRNA'] = isomir_counts.index.str.extract(r'(hsa-\w+-\d+[a-z]*)')[0] summary = isomir_counts.groupby('miRNA').agg({ 'count': ['sum', 'count', lambda x: x.idxmax()] }) summary.columns = ['total_reads', 'n_isomirs', 'dominant_isomir'] return summary
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->
Other measured skills in the registry, with their headline benchmark lift.