Install any skill in seconds. Free to start, no credit card required.
Get Started Free →Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
.claude/skills/bio-small-rna-seq-smrna-preprocessing/SKILL.md| Test case | Without → With | Effect | Δ tokens | Δ turns |
|---|---|---|---|---|
| case-01 | ✗→✓ | ▲ Improved | -1% | 0% |
| case-07 | ✗→✓ | ▲ Improved | 41% | 0% |
| case-08 | ✗→✓ | ▲ Improved | 31% | 0% |
| case-05 | ✗→✓ | ▲ Improved | 33% | 0% |
| case-09 | ✗→✓ | ▲ Improved | 30% | 0% |
<!--
#
#
-->
Small RNA libraries have specific 3' adapters that must be removed:
bash# Standard Illumina TruSeq small RNA adapter cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -M 30 \ --discard-untrimmed \ -o trimmed.fastq.gz \ input.fastq.gz # -a: 3' adapter sequence # -m 18: Minimum length (miRNAs are 18-25 nt) # -M 30: Maximum length (exclude longer fragments) # --discard-untrimmed: Remove reads without adapter (likely not small RNA)
| Kit | 3' Adapter Sequence | |-----|---------------------| | Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG | | NEBNext | AGATCGGAAGAGCACACGTCT | | QIAseq | AACTGTAGGCACCATCAAT | | Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
bash# Filter by length after trimming cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 -M 26 \ -o mirna_length.fastq.gz \ input.fastq.gz # miRNA: 18-26 nt (typically 21-23 nt) # piRNA: 26-32 nt # snoRNA: variable, typically longer
bash# Trim low-quality bases from 3' end before adapter removal cutadapt \ -q 20 \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -o trimmed.fastq.gz \ input.fastq.gz
bash# fastp with small RNA settings fastp \ --in1 input.fastq.gz \ --out1 trimmed.fastq.gz \ --adapter_sequence TGGAATTCTCGGGTGCCAAGG \ --length_required 18 \ --length_limit 30 \ --html report.html # Note: fastp auto-detects adapters but specifying is more reliable
For small RNAs, collapsing identical sequences reduces computation:
bash# Using seqkit seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta # Using fastx_toolkit (legacy) fastx_collapser -i trimmed.fastq -o collapsed.fasta
pythonimport gzip from collections import Counter def collapse_reads(fastq_path): '''Collapse identical sequences and count occurrences''' counts = Counter() with gzip.open(fastq_path, 'rt') as f: while True: header = f.readline() if not header: break seq = f.readline().strip() f.readline() # + f.readline() # qual # Only keep reads in miRNA size range if 18 <= len(seq) <= 26: counts[seq] += 1 return counts # Write collapsed FASTA def write_collapsed_fasta(counts, output_path): with open(output_path, 'w') as f: for i, (seq, count) in enumerate(counts.most_common()): f.write(f'>seq_{i}_x{count}\n{seq}\n')
Key metrics to check:
pythonimport matplotlib.pyplot as plt from collections import Counter def plot_length_distribution(fastq_path): lengths = Counter() with gzip.open(fastq_path, 'rt') as f: for i, line in enumerate(f): if i % 4 == 1: # Sequence line lengths[len(line.strip())] += 1 plt.bar(lengths.keys(), lengths.values()) plt.xlabel('Read Length') plt.ylabel('Count') plt.title('Small RNA Length Distribution') plt.savefig('length_dist.png')
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->
| Case | Status | Duration (ms) | Turns | Tokens | Tool calls | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Without | With | Δ | Without | With | Δ | Without | With | Δ | Without | With | Δ | ||
case-01 | fail→pass | 13,458 | 6,834 | -49% | 1 | 1 | 0% | 2,655 | 2,616 | -1% | 0 | 0 | — |
case-02 | pass→pass | 8,392 | 5,769 | -31% | 1 | 1 | 0% | 1,636 | 2,324 | +42% | 0 | 0 | — |
case-07 | fail→pass | 6,279 | 2,034 | -68% | 1 | 1 | 0% | 1,101 | 1,553 | +41% | 0 | 0 | — |
case-08 | fail→pass | 21,509 | 3,387 | -84% | 1 | 1 | 0% | 1,332 | 1,748 | +31% | 0 | 0 | — |
case-03 | pass→pass | 6,912 | 2,848 | -59% | 1 | 1 | 0% | 1,408 | 1,738 | +23% | 0 | 0 | — |
case-04 | fail→fail | 16,397 | 6,584 | -60% | 1 | 1 | 0% | 918 | 2,512 | +174% | 0 | 0 | — |
case-05 | fail→pass | 7,770 | 3,742 | -52% | 1 | 1 | 0% | 1,473 | 1,962 | +33% | 0 | 0 | — |
case-06 | pass→pass | 12,282 | 3,343 | -73% | 1 | 1 | 0% | 2,161 | 1,878 | -13% | 0 | 0 | — |
case-09 | fail→pass | 10,326 | 6,925 | -33% | 1 | 1 | 0% | 1,958 | 2,555 | +30% | 0 | 0 | — |
case-10 | pass→pass | 5,407 | 2,870 | -47% | 1 | 1 | 0% | 1,085 | 1,780 | +64% | 0 | 0 | — |
case-11 | pass→pass | 4,415 | 3,062 | -31% | 1 | 1 | 0% | 767 | 1,705 | +122% | 0 | 0 | — |
case-12 | pass→pass | 9,288 | 4,785 | -48% | 1 | 1 | 0% | 1,637 | 2,028 | +24% | 0 | 0 | — |
case-13 | pass→pass | 2,709 | 1,838 | -32% | 1 | 1 | 0% | 500 | 1,510 | +202% | 0 | 0 | — |
case-14 | pass→pass | 5,723 | 2,071 | -64% | 1 | 1 | 0% | 1,077 | 1,592 | +48% | 0 | 0 | — |
case-15 | pass→pass | 2,927 | 1,899 | -35% | 1 | 1 | 0% | 587 | 1,549 | +164% | 0 | 0 | — |
case-16 | pass→pass | 9,999 | 2,349 | -77% | 1 | 1 | 0% | 1,839 | 1,615 | -12% | 0 | 0 | — |
case-17 | pass→pass | 11,757 | 3,767 | -68% | 1 | 1 | 0% | 2,177 | 1,737 | -20% | 0 | 0 | — |
case-18 | pass→pass | 8,833 | 2,040 | -77% | 1 | 1 | 0% | 1,599 | 1,589 | -1% | 0 | 0 | — |
case-19 | pass→pass | 4,355 | 2,273 | -48% | 1 | 1 | 0% | 799 | 1,597 | +100% | 0 | 0 | — |
case-20 | pass→pass | 15,903 | 15,975 | +0% | 1 | 1 | 0% | 2,917 | 4,222 | +45% | 0 | 0 | — |
case-21 | pass→pass | 9,974 | 5,673 | -43% | 1 | 1 | 0% | 1,786 | 2,242 | +26% | 0 | 0 | — |
case-22 | pass→pass | 12,508 | 6,254 | -50% | 1 | 1 | 0% | 2,529 | 2,455 | -3% | 0 | 0 | — |
DecimalAI ran this skill against gemini-3.6-flash twice over the same eval suite — once with the skill loaded and once without — and compared the two runs case by case. 22 cases were attempted, and 20 counted toward the lift figure. The other 2 produced results that are not comparable between the two arms, so they are excluded from the headline rather than averaged into it. The headline lift of +23 percentage points is the difference between those two pass rates over the 20 comparable cases.
Without the skill loaded, the model failed this case. With it loaded, the same prompt on the same model passed. This is one improved case from the latest verified run; every case, including any that regressed, is in the table above.
| Model | Method | Date | Lift |
|---|---|---|---|
| gemini-3.6-flash | verified | 7/26/2026 | +27% |
Other measured skills in the registry, with their headline benchmark lift.