Install any skill in seconds. Free to start, no credit card required.
Get Started Free →Molecular cloning assembly design — Gibson Assembly (overlap design for seamless multi-fragment joining) and Golden Gate Assembly (Type IIS / BsaI / BbsI design with unique 4-bp fusion overhangs). Use when you need to plan how to join DNA fragments into a construct, design assembly overlaps/overhangs, or decide between cloning methods. Covers the domestication (internal-site removal), overhang-uniqueness, and overlap-Tm rules. For PCR primers to generate the fragments, see tooluniverse-primer-de
.claude/skills/mims-harvard-tooluniverse-molecular-cloning/SKILL.md| Test case | Without → With | Effect | Δ tokens | Δ turns |
|---|---|---|---|---|
| case-03 | ✗→✓ | ▲ Improved | 3% | 0% |
| case-04 | ✗→✓ | ▲ Improved | 16% | 0% |
| case-05 | ✗→✓ | ▲ Improved | 14% | 0% |
| case-08 | ✗→✓ | ▲ Improved | 54% | 0% |
| case-13 | ✗→✓ | ▲ Improved | -32% | 0% |
Plan how to join DNA fragments into a construct: design the overlaps (Gibson) or Type IIS overhangs (Golden Gate) and avoid the failures that come from internal sites and non-unique junctions.
| Use Gibson Assembly when | Use Golden Gate when | |---|---| | A few fragments, scarless/seamless junctions anywhere you choose | Many parts, standardized reusable parts (MoClo/modular), one-pot | | You can add ~20–40 bp homology by PCR | You can remove internal BsaI/BbsI sites (domestication) | | One-off constructs | Combinatorial libraries / repeated assemblies |
Both are sequence-independent (no scar at the junction for Gibson; a 4-bp fusion scar for Golden Gate). For 2–4 unique fragments, Gibson is usually simplest; for libraries or a parts toolkit, Golden Gate.
bashtu run DNA_gibson_design '{"operation":"gibson_design", "fragments":["ATGGCG...GAGGAC","GAGGAC...GGCAAG","GGGCAAG...ATCCT"], "overlap_length":20}'
For each fragment it returns left_overlap, right_overlap, and with_overlaps (the fragment extended with the homology arms you'd add to your PCR primers — hand these to tooluniverse-primer-design).
Gibson design rules
bashtu run DNA_golden_gate_design '{"operation":"golden_gate_design", "parts":["ATGGCG...AAGAAC","CTGAGC...CTGATC","GAGGAG...GTGGTG"], "enzyme":"BsaI"}'
Returns parts_with_overhangs: each part's unique 4-bp left_overhang/right_overhang and the full_sequence flanked by the Type IIS recognition sites (e.g. BsaI GGTCTC(N1) … cutting outside its site to leave the 4-bp fusion overhang).
Golden Gate design rules
GGTCTC, BbsI GAAGAC) must NOT occur inside any part, or it will be cut internally. Remove internal sites by silent mutation before assembly — check every part. Don't rely on memorized recognition sites for a less common enzyme, or when a part's internal site can't be silently removed and you need an isoschizomer instead: REBASE_get_enzyme (site + methylation sensitivity) and REBASE_list_isoschizomers (alternative enzymes cutting the same site) are the authoritative lookup.scripts/cloning_qc.py screens parts for the problems above: internal BsaI/BbsI sites (Golden Gate), overhang uniqueness/palindromes, and Gibson overlap GC/length — and flags PASS/WARN.
tooluniverse-primer-design (and BLAST for specificity).The reverse question ("I combined these plasmids in a Golden Gate reaction with Esp3I — what does the product express / what does the gRNA target?") is answered by one call. Do not hand-write a digestion/ligation simulator.
bashtu run DNA_golden_gate_assemble '{"fragments":["<plasmid1>","<plasmid2>","<plasmid3>"], "enzyme":"Esp3I","labels":["pLAB-CTU","pLAB-gTU2E","pLAB-CH3"]}'
It digests each input, drops the fragments that keep a recognition site (those are re-cut in the reaction and cannot persist), chains the rest by matching 4-bp overhangs, and returns product_sequence, product_length and the assembly_order with the overhang at every junction. Inputs are treated as circular plasmids unless you pass circular: false.
Then annotate the product. Locate features in product_sequence (promoter, ORF, gRNA spacer). For a gRNA cassette the spacer is the ~20 nt immediately 5′ of the scaffold (GTTTTAGAGCTAGAAATAGCAAG); identify its target by matching that spacer against the genome (BLAST_*, or an Ensembl/NCBI/SGD sequence lookup) and check for an adjacent PAM. Match the species implied by the construct — yeast tRNA/Pol III parts mean search the yeast genome, not human.
If the assembly reports that the fragments do not chain, digest the inputs individually with DNA_virtual_digest (circular: true) to see what each released: a Golden Gate donor carries its two Type IIS sites inverted around the insert, so a correct digest gives 2 fragments per plasmid. Getting 1 means the enzyme name or circular is wrong — not that the plasmid lacks sites.
Enzyme names: Esp3I and BsmBI are the same enzyme (CGTCTC); BsaI (GGTCTC), BbsI (GAAGAC) and SapI (GCTCTTC) all resolve too.
DNA_virtual_digestand DNA_golden_gate_assemble cut both strands at each enzyme's real offset, including Type IIS enzymes that cut outside their site). What is not modelled is reaction efficiency — overhang ligation bias, partial digestion, incorrect-but-possible junctions — so a returned product is the intended assembly, not a yield prediction. Validate by sequencing the assembled construct.
tooluniverse-primer-design — design the PCR primers (with homology arms / Type IIS tails) to make the fragments.tooluniverse-sequence-analysis — handle the input sequences.| Case | Status | Duration (ms) | Turns | Tokens | Tool calls | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Without | With | Δ | Without | With | Δ | Without | With | Δ | Without | With | Δ | ||
case-01 | pass→pass | 15,729 | 11,600 | -26% | 1 | 1 | 0% | 2,468 | 2,999 | +22% | 0 | 0 | — |
case-02 | pass→pass | 11,065 | 5,785 | -48% | 1 | 1 | 0% | 1,869 | 2,089 | +12% | 0 | 0 | — |
case-03 | fail→pass | 8,809 | 2,951 | -67% | 1 | 1 | 0% | 1,612 | 1,663 | +3% | 0 | 0 | — |
case-04 | fail→pass | 8,979 | 4,778 | -47% | 1 | 1 | 0% | 1,606 | 1,857 | +16% | 0 | 0 | — |
case-05 | fail→pass | 12,042 | 8,402 | -30% | 1 | 1 | 0% | 2,155 | 2,464 | +14% | 0 | 0 | — |
case-06 | pass→pass | 8,848 | 8,074 | -9% | 1 | 1 | 0% | 1,637 | 2,447 | +49% | 0 | 0 | — |
case-07 | pass→pass | 11,038 | 7,753 | -30% | 1 | 1 | 0% | 1,734 | 2,295 | +32% | 0 | 0 | — |
case-08 | fail→pass | 23,911 | 3,099 | -87% | 1 | 1 | 0% | 1,103 | 1,695 | +54% | 0 | 0 | — |
case-09 | pass→pass | 7,545 | 6,304 | -16% | 1 | 1 | 0% | 1,470 | 2,180 | +48% | 0 | 0 | — |
case-10 | pass→pass | 10,404 | 7,667 | -26% | 1 | 1 | 0% | 1,928 | 2,443 | +27% | 0 | 0 | — |
case-16 | pass→pass | 9,272 | 6,706 | -28% | 1 | 1 | 0% | 1,855 | 2,356 | +27% | 0 | 0 | — |
case-11 | pass→pass | 14,458 | 11,422 | -21% | 1 | 1 | 0% | 2,617 | 3,147 | +20% | 0 | 0 | — |
case-12 | pass→pass | 8,563 | 5,083 | -41% | 1 | 1 | 0% | 1,492 | 1,960 | +31% | 0 | 0 | — |
case-13 | fail→pass | 11,392 | 1,762 | -85% | 1 | 1 | 0% | 2,054 | 1,400 | -32% | 0 | 0 | — |
case-14 | fail→pass | 11,484 | 5,671 | -51% | 1 | 1 | 0% | 1,961 | 2,112 | +8% | 0 | 0 | — |
case-15 | pass→pass | 9,436 | 4,190 | -56% | 1 | 1 | 0% | 1,733 | 1,847 | +7% | 0 | 0 | — |
case-17 | pass→pass | 13,222 | 4,985 | -62% | 1 | 1 | 0% | 2,187 | 2,007 | -8% | 0 | 0 | — |
case-18 | pass→pass | 16,465 | 6,272 | -62% | 1 | 1 | 0% | 2,245 | 2,133 | -5% | 0 | 0 | — |
case-19 | pass→pass | 12,198 | 8,254 | -32% | 1 | 1 | 0% | 2,471 | 2,514 | +2% | 0 | 0 | — |
case-20 | pass→pass | 13,292 | 10,835 | -18% | 1 | 1 | 0% | 2,269 | 3,158 | +39% | 0 | 0 | — |
case-21 | pass→pass | 2,455 | 3,425 | +40% | 1 | 1 | 0% | 383 | 1,632 | +326% | 0 | 0 | — |
case-22 | fail→fail | 29,133 | 26,814 | -8% | 1 | 1 | 0% | 6,165 | 7,146 | +16% | 0 | 0 | — |
DecimalAI ran this skill against gemini-3.6-flash twice over the same eval suite — once with the skill loaded and once without — and compared the two runs case by case. 22 cases were attempted, and 21 counted toward the lift figure. The other 1 produced results that are not comparable between the two arms, so they are excluded from the headline rather than averaged into it. The headline lift of +27 percentage points is the difference between those two pass rates over the 21 comparable cases.
The publisher has shipped newer versions since this run, so these numbers describe v1, not the version currently listed.
Without the skill loaded, the model failed this case. With it loaded, the same prompt on the same model passed. This is one improved case from the latest verified run; every case, including any that regressed, is in the table above.
Other measured skills in the registry, with their headline benchmark lift.