Ready to supercharge your AI agents?

Install any skill in seconds. Free to start, no credit card required.

Molecular Cloning Assembly Design (Gibson & Golden Gate) · mims-harvard | DecimalAI

Scienceby mims-harvard

Molecular Cloning Assembly Design (Gibson & Golden Gate)

Molecular cloning assembly design — Gibson Assembly (overlap design for seamless multi-fragment joining) and Golden Gate Assembly (Type IIS / BsaI / BbsI design with unique 4-bp fusion overhangs).

Maintained

SkillScore

SkillScore74/100

Test results 74

Safety

3/3 safety checks passed

Code scan
Intent
Content

What it changes

61%74%of test cases passed +13 pts

Without skill14 of 23

With skill17 of 23

4 fixed13 passed either way5 still failing1 broke

Measured on gemini-3.6-flash8/9/2026v2 · latest is v3

This benchmark measured an earlier version of the skill.

Track record

Agent runs: 0; All time

See one task, with and without the skill

One test taskI have 3 DNA parts that I want to prepare for BsaI assembly. I need the 4-bp junction overhangs and Type IIS recognition sites generated automatically. Which tool operation handles this?

Without the skillMissed

With the skillPassed

Same model, same task. Answers are capped and redacted.

Use this skill

Your agent runs on

Adds every file the skill has, pinned so you can update it. No account needed.

pip install "decimalai>=0.15"
decimalai skills add tooluniverse-molecular-cloning
claude --plugin-dir "$(git rev-parse --show-toplevel 2>/dev/null || pwd)/.agents"

The same install from Python, for a notebook or a setup script.

Install

pip install "decimalai>=0.15"

Add the skill

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

print("Added. Start Claude Code with the command below.")

Start Claude Code with it

claude --plugin-dir "$(git rev-parse --show-toplevel 2>/dev/null || pwd)/.agents"

Type these in a Claude Code session. No account or API key. It writes the skill and any files it bundles, and asks first when its safety rating isn't Passed.

Add the DecimalAI plugin, once

/plugin marketplace add decimal-labs/decimalai-claude-plugins
/plugin install decimalai@decimalai

Install this skill

/decimalai:install tooluniverse-molecular-cloning

The plugin needs python3 and curl on your machine.

No Python or account. Claude Code picks it up in its next session.

Save it into your project

curl -fsSL --create-dirs -o .claude/skills/tooluniverse-molecular-cloning/SKILL.md https://app.decimal.ai/s/tooluniverse-molecular-cloning/SKILL.md

Copy SKILL.md

Save it in your project, as

.claude/skills/tooluniverse-molecular-cloning/SKILL.md

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Claude Code docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[claude-agent-sdk]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import asyncio

from claude_agent_sdk import ClaudeAgentOptions
from decimalai.claude_agent_sdk import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

async def main():
    question = "Hello!"
    async with support.run(question) as run:  # one user message, one run
        async for message in run.query(options=ClaudeAgentOptions(max_turns=6)):
            print(message)

# In a notebook or async code: await main()
asyncio.run(main())

Prefer its own loader? ClaudeAgentOptions(plugins=[skills_plugin()], skills="all") reads the same folder. Use one or the other: a skill delivered both ways reaches the prompt twice.

The same install from Python, for a notebook or a setup script. agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[claude-agent-sdk]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import asyncio

from claude_agent_sdk import ClaudeAgentOptions
from decimalai.claude_agent_sdk import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

async def main():
    question = "Hello!"
    async with support.run(question) as run:  # one user message, one run
        async for message in run.query(options=ClaudeAgentOptions(max_turns=6)):
            print(message)

# In a notebook or async code: await main()
asyncio.run(main())

Prefer its own loader? ClaudeAgentOptions(plugins=[skills_plugin()], skills="all") reads the same folder. Use one or the other: a skill delivered both ways reaches the prompt twice.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

import asyncio
from pathlib import Path
from claude_agent_sdk import ClaudeAgentOptions, query

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
options = ClaudeAgentOptions(system_prompt=f"You are a helpful agent.\n\n{skill}", max_turns=6)

async def main():
    async for message in query(prompt="Hello!", options=options):
        print(message)

# In a notebook or async code: await main()
asyncio.run(main())

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Claude Agent SDK docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[openai-agents]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from agents import Agent, Runner
from decimalai.openai_agents import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = Agent(
    name=support.name,
    instructions=support.instructions,  # your prompt, then the skill list
    tools=[*support.tools],             # your tools, then load_skill
)
# In a notebook or async code: result = await Runner.run(agent, "Hello!")
result = Runner.run_sync(agent, "Hello!")

Using SandboxAgent? capabilities=[Shell(), decimalai.openai_agents.sandbox_skills()] points its own loader at the same folder.

Install

pip install "decimalai[openai-agents]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from agents import Agent, Runner
from decimalai.openai_agents import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = Agent(
    name=support.name,
    instructions=support.instructions,  # your prompt, then the skill list
    tools=[*support.tools],             # your tools, then load_skill
)
# In a notebook or async code: result = await Runner.run(agent, "Hello!")
result = Runner.run_sync(agent, "Hello!")

Using SandboxAgent? capabilities=[Shell(), decimalai.openai_agents.sandbox_skills()] points its own loader at the same folder.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from agents import Agent, Runner

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = Agent(name="support", instructions=f"You are a helpful agent.\n\n{skill}")
# In a notebook or async code: result = await Runner.run(agent, "Hello!")
result = Runner.run_sync(agent, "Hello!")

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

OpenAI Agents docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[openai]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import json

from openai import OpenAI
from decimalai.openai import agent_config

client = OpenAI()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")


def lookup_order(order_id: str) -> str:
    return f"Order {order_id} shipped yesterday."


# Your tools, as Chat Completions takes them, and what answers each.
TOOLS = [{"type": "function", "function": {
    "name": "lookup_order",
    "description": "Look up the status of an order.",
    "parameters": {"type": "object", "properties": {"order_id": {"type": "string"}},
                   "required": ["order_id"]},
}}]
FUNCTIONS = {"lookup_order": lookup_order}

question = "Where is order A1001?"
with support.run(question) as run:  # one user message, one run
    # run.system is your prompt, then the skill list.
    messages = [{"role": "system", "content": run.system}, run.message]
    while True:
        reply = client.chat.completions.create(
            model="gpt-5.4-mini",
            messages=messages,
            tools=[*TOOLS, *run.tools],  # your tools, then load_skill
        ).choices[0].message
        messages.append(reply)
        if not reply.tool_calls:
            break
        for call in reply.tool_calls:
            # load_skill is answered by the run; your own tools by FUNCTIONS.
            function = FUNCTIONS.get(call.function.name)
            messages.append(run.tool_result(call) or {
                "role": "tool", "tool_call_id": call.id,
                "content": function(**json.loads(call.function.arguments)) if function
                else f"There is no tool named {call.function.name!r}.",
            })
print(reply.content)

# The Responses API takes run.response_tools instead of run.tools.

Install

pip install "decimalai[openai]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import json

from openai import OpenAI
from decimalai.openai import agent_config

client = OpenAI()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")


def lookup_order(order_id: str) -> str:
    return f"Order {order_id} shipped yesterday."


# Your tools, as Chat Completions takes them, and what answers each.
TOOLS = [{"type": "function", "function": {
    "name": "lookup_order",
    "description": "Look up the status of an order.",
    "parameters": {"type": "object", "properties": {"order_id": {"type": "string"}},
                   "required": ["order_id"]},
}}]
FUNCTIONS = {"lookup_order": lookup_order}

question = "Where is order A1001?"
with support.run(question) as run:  # one user message, one run
    # run.system is your prompt, then the skill list.
    messages = [{"role": "system", "content": run.system}, run.message]
    while True:
        reply = client.chat.completions.create(
            model="gpt-5.4-mini",
            messages=messages,
            tools=[*TOOLS, *run.tools],  # your tools, then load_skill
        ).choices[0].message
        messages.append(reply)
        if not reply.tool_calls:
            break
        for call in reply.tool_calls:
            # load_skill is answered by the run; your own tools by FUNCTIONS.
            function = FUNCTIONS.get(call.function.name)
            messages.append(run.tool_result(call) or {
                "role": "tool", "tool_call_id": call.id,
                "content": function(**json.loads(call.function.arguments)) if function
                else f"There is no tool named {call.function.name!r}.",
            })
print(reply.content)

# The Responses API takes run.response_tools instead of run.tools.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from openai import OpenAI

client = OpenAI()
skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
reply = client.chat.completions.create(
    model="gpt-5.4-mini",
    messages=[
        {"role": "system", "content": f"You are a helpful agent.\n\n{skill}"},
        {"role": "user", "content": "Hello!"},
    ],
).choices[0].message

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

OpenAI SDK docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[anthropic]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import anthropic
from decimalai.anthropic import agent_config

client = anthropic.Anthropic()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

question = "Hello!"
with support.run(question) as run:  # one user message, one run
    answer = client.beta.messages.tool_runner(
        model="claude-haiku-5-5",
        max_tokens=4096,
        system=run.system,     # your prompt, then the skill list
        tools=[*run.tools],    # your tools, then load_skill
        messages=[{"role": "user", "content": question}],
    ).until_done()

Install

pip install "decimalai[anthropic]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import anthropic
from decimalai.anthropic import agent_config

client = anthropic.Anthropic()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

question = "Hello!"
with support.run(question) as run:  # one user message, one run
    answer = client.beta.messages.tool_runner(
        model="claude-haiku-5-5",
        max_tokens=4096,
        system=run.system,     # your prompt, then the skill list
        tools=[*run.tools],    # your tools, then load_skill
        messages=[{"role": "user", "content": question}],
    ).until_done()

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
import anthropic

client = anthropic.Anthropic()
skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
reply = client.messages.create(
    model="claude-haiku-5-5",
    max_tokens=4096,
    system=f"You are a helpful agent.\n\n{skill}",
    messages=[{"role": "user", "content": "Hello!"}],
)

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Anthropic docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[google-genai]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from google import genai
from google.genai import types
from decimalai.google_genai import agent_config

client = genai.Client()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")


def lookup_order(order_id: str) -> str:
    return f"Order {order_id} shipped yesterday."


# Your functions, as declarations for the model, and what answers each.
TOOLS = [{"function_declarations": [{
    "name": "lookup_order",
    "description": "Look up the status of an order.",
    "parameters_json_schema": {"type": "object", "properties": {"order_id": {"type": "string"}},
                               "required": ["order_id"]},
}]}]
FUNCTIONS = {"lookup_order": lookup_order}

question = "Where is order A1001?"
with support.run(question) as run:  # one user message, one run
    config = types.GenerateContentConfig(
        system_instruction=run.system,     # your prompt, then the skill list
        tools=[*TOOLS, *run.tool_params],  # your functions, then load_skill
    )
    contents = [{"role": "user", "parts": [{"text": run.message}]}]
    while True:
        response = client.models.generate_content(
            model="gemini-3.5-flash", contents=contents, config=config,
        )
        if not response.function_calls:
            break
        contents.append(response.candidates[0].content)
        parts = []
        for call in response.function_calls:
            # load_skill is answered by the run; your own functions by FUNCTIONS.
            # A loop of your own rather than automatic function calling, which
            # raises KeyError when the model asks for a function you did not pass.
            function = FUNCTIONS.get(call.name)
            parts.append(run.tool_result(call) or {"function_response": {
                "name": call.name, "id": call.id,
                "response": {"result": function(**(call.args or {})) if function
                             else f"There is no function named {call.name!r}."},
            }})
        contents.append({"role": "user", "parts": parts})
print(response.text)

Install

pip install "decimalai[google-genai]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from google import genai
from google.genai import types
from decimalai.google_genai import agent_config

client = genai.Client()
# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")


def lookup_order(order_id: str) -> str:
    return f"Order {order_id} shipped yesterday."


# Your functions, as declarations for the model, and what answers each.
TOOLS = [{"function_declarations": [{
    "name": "lookup_order",
    "description": "Look up the status of an order.",
    "parameters_json_schema": {"type": "object", "properties": {"order_id": {"type": "string"}},
                               "required": ["order_id"]},
}]}]
FUNCTIONS = {"lookup_order": lookup_order}

question = "Where is order A1001?"
with support.run(question) as run:  # one user message, one run
    config = types.GenerateContentConfig(
        system_instruction=run.system,     # your prompt, then the skill list
        tools=[*TOOLS, *run.tool_params],  # your functions, then load_skill
    )
    contents = [{"role": "user", "parts": [{"text": run.message}]}]
    while True:
        response = client.models.generate_content(
            model="gemini-3.5-flash", contents=contents, config=config,
        )
        if not response.function_calls:
            break
        contents.append(response.candidates[0].content)
        parts = []
        for call in response.function_calls:
            # load_skill is answered by the run; your own functions by FUNCTIONS.
            # A loop of your own rather than automatic function calling, which
            # raises KeyError when the model asks for a function you did not pass.
            function = FUNCTIONS.get(call.name)
            parts.append(run.tool_result(call) or {"function_response": {
                "name": call.name, "id": call.id,
                "response": {"result": function(**(call.args or {})) if function
                             else f"There is no function named {call.name!r}."},
            }})
        contents.append({"role": "user", "parts": parts})
print(response.text)

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from google import genai
from google.genai import types

client = genai.Client()
skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
response = client.models.generate_content(
    model="gemini-3.5-flash",
    contents="Hello!",
    config=types.GenerateContentConfig(system_instruction=f"You are a helpful agent.\n\n{skill}"),
)

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Gemini API docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[langchain]" langchain-openai
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from langchain.agents import create_agent
from decimalai.langchain import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = create_agent(
    "openai:gpt-5.4-mini",
    tools=[],                         # your tools; the middleware adds load_skill
    middleware=[support.middleware],  # your prompt, the skill list and load_skill
)
result = agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

Install

pip install "decimalai[langchain]" langchain-openai

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from langchain.agents import create_agent
from decimalai.langchain import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = create_agent(
    "openai:gpt-5.4-mini",
    tools=[],                         # your tools; the middleware adds load_skill
    middleware=[support.middleware],  # your prompt, the skill list and load_skill
)
result = agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from langchain.agents import create_agent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = create_agent("openai:gpt-5.4-mini", tools=[], system_prompt=f"You are a helpful agent.\n\n{skill}")
result = agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

LangChain docs

CrewAI's own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" "crewai>=1.15.27"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import decimalai.crewai
from crewai import Agent, Crew, Task

agent = Agent(
    role="Support", goal="Help the customer", backstory="A support agent.",
    llm=llm,                               # your own CrewAI LLM
    skills=decimalai.crewai.skills(),      # the installed folder
    tools=decimalai.crewai.skill_tools(),  # reads a skill's files, runs its scripts
)
task = Task(description="Hello!", expected_output="an answer", agent=agent)
Crew(agents=[agent], tasks=[task]).kickoff()

The same install from Python, for a notebook or a setup script. CrewAI's own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" "crewai>=1.15.27"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import decimalai.crewai
from crewai import Agent, Crew, Task

agent = Agent(
    role="Support", goal="Help the customer", backstory="A support agent.",
    llm=llm,                               # your own CrewAI LLM
    skills=decimalai.crewai.skills(),      # the installed folder
    tools=decimalai.crewai.skill_tools(),  # reads a skill's files, runs its scripts
)
task = Task(description="Hello!", expected_output="an answer", agent=agent)
Crew(agents=[agent], tasks=[task]).kickoff()

No DecimalAI package. CrewAI's own loader reads the folder, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from crewai import Agent, Crew, Task

agent = Agent(
    role="Support", goal="Help the customer", backstory="A support agent.",
    llm=llm,                         # your own CrewAI LLM
    skills=[Path(".agents/skills")],
)
task = Task(description="Hello!", expected_output="an answer", agent=agent)
Crew(agents=[agent], tasks=[task]).kickoff()

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

CrewAI docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[adk]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from decimalai.adk import DecimalAIPlugin, agent_config
from google.adk.agents import LlmAgent
from google.adk.apps import App

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = LlmAgent(
    name="support",          # ADK needs a Python identifier
    model="gemini-3.5-flash",
    instruction=support.instruction,  # your prompt, then the skill list
    tools=[*support.tools],           # your tools, then load_skill
)
# DecimalAIPlugin makes each invocation of runners built from this App one trace.
app = App(name="support", root_agent=agent, plugins=[DecimalAIPlugin()])

Prefer ADK's own loader? SkillToolset(skills=decimalai.adk.skills(), ...) reads the same folder. Use one or the other: a skill delivered both ways reaches the prompt twice.

Install

pip install "decimalai[adk]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from decimalai.adk import DecimalAIPlugin, agent_config
from google.adk.agents import LlmAgent
from google.adk.apps import App

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = LlmAgent(
    name="support",          # ADK needs a Python identifier
    model="gemini-3.5-flash",
    instruction=support.instruction,  # your prompt, then the skill list
    tools=[*support.tools],           # your tools, then load_skill
)
# DecimalAIPlugin makes each invocation of runners built from this App one trace.
app = App(name="support", root_agent=agent, plugins=[DecimalAIPlugin()])

Prefer ADK's own loader? SkillToolset(skills=decimalai.adk.skills(), ...) reads the same folder. Use one or the other: a skill delivered both ways reaches the prompt twice.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from google.adk.agents import LlmAgent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = LlmAgent(
    name="support",
    model="gemini-3.5-flash",
    instruction=lambda context: f"You are a helpful agent.\n\n{skill}",
)

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Google ADK docs

agent_config() hands your agent the skill. With no DecimalAI key it reads your project's files and sends nothing. Needs SDK 0.27 or newer.

Install

pip install "decimalai[pydantic-ai]"
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from pydantic_ai import Agent
from decimalai.pydantic_ai import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = Agent(
    "openai:gpt-4o-mini",
    name=support.name,
    tools=[],                 # your tools; the capability adds load_skill
    capabilities=[support],   # your prompt, the skill list and load_skill
)
# In a notebook or async code: result = await agent.run("Hello!")
result = agent.run_sync("Hello!")

On the Pydantic AI harness, decimalai.pydantic_ai_harness.skills(project) uses its own loader instead.

Install

pip install "decimalai[pydantic-ai]"

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from pydantic_ai import Agent
from decimalai.pydantic_ai import agent_config

# With no DECIMAL_API_KEY this reads the skills your project lists, from disk.
support = agent_config("support", fallback="You are a helpful agent.")

agent = Agent(
    "openai:gpt-4o-mini",
    name=support.name,
    tools=[],                 # your tools; the capability adds load_skill
    capabilities=[support],   # your prompt, the skill list and load_skill
)
# In a notebook or async code: result = await agent.run("Hello!")
result = agent.run_sync("Hello!")

On the Pydantic AI harness, decimalai.pydantic_ai_harness.skills(project) uses its own loader instead.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from pydantic_ai import Agent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = Agent("openai:gpt-4o-mini", instructions=f"You are a helpful agent.\n\n{skill}")
# In a notebook or async code: result = await agent.run("Hello!")
result = agent.run_sync("Hello!")

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Pydantic AI docs

Deep Agents' own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" deepagents
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import decimalai.deepagents
from deepagents import create_deep_agent

agent = create_deep_agent(model=model, **decimalai.deepagents.skills())
agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

The default backend reads files but has no shell. To run a skill's scripts, pass skills(backend=LocalShellBackend(...)).

The same install from Python, for a notebook or a setup script. Deep Agents' own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" deepagents

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import decimalai.deepagents
from deepagents import create_deep_agent

agent = create_deep_agent(model=model, **decimalai.deepagents.skills())
agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

The default backend reads files but has no shell. To run a skill's scripts, pass skills(backend=LocalShellBackend(...)).

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from deepagents import create_deep_agent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = create_deep_agent(model=model, system_prompt=f"You are a helpful agent.\n\n{skill}")
agent.invoke({"messages": [{"role": "user", "content": "Hello!"}]})

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Deep Agents docs

Its own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" agent-framework
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

import asyncio

from agent_framework import Agent
from decimalai.agent_framework import skills

agent = Agent(client=client, instructions="You are a helpful agent.", context_providers=[skills()])
asyncio.run(agent.run("Hello!"))

It caches skills by default, so restart the process after decimalai skills update.

The same install from Python, for a notebook or a setup script. Its own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" agent-framework

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

import asyncio

from agent_framework import Agent
from decimalai.agent_framework import skills

agent = Agent(client=client, instructions="You are a helpful agent.", context_providers=[skills()])
asyncio.run(agent.run("Hello!"))

It caches skills by default, so restart the process after decimalai skills update.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

import asyncio
from pathlib import Path
from agent_framework import Agent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = Agent(client=client, instructions=f"You are a helpful agent.\n\n{skill}")
asyncio.run(agent.run("Hello!"))

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Microsoft Agent Framework docs

Strands' own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" strands-agents
decimalai skills add tooluniverse-molecular-cloning

Add it to your agent

from decimalai.strands import skills
from strands import Agent
from strands.vended_tools import file_editor, shell

agent = Agent(
    model=model,                # always pass one: the default is Amazon Bedrock
    system_prompt="You are a helpful agent.",
    tools=[file_editor, shell],
    plugins=[skills()],
)
agent("Hello!")

Strands loads an agent's skills once, so build the agent again after decimalai skills update.

The same install from Python, for a notebook or a setup script. Strands' own skill loader reads the installed folder. No DecimalAI account needed.

Install

pip install "decimalai>=0.16" strands-agents

Add it to your agent

from decimalai import skillpkg

# Writes .agents/skills and .decimal/skills.toml. Safe to run twice.
result = skillpkg.add("tooluniverse-molecular-cloning")
if result.exit_code:
    raise SystemExit(result.problems)

from decimalai.strands import skills
from strands import Agent
from strands.vended_tools import file_editor, shell

agent = Agent(
    model=model,                # always pass one: the default is Amazon Bedrock
    system_prompt="You are a helpful agent.",
    tools=[file_editor, shell],
    plugins=[skills()],
)
agent("Hello!")

Strands loads an agent's skills once, so build the agent again after decimalai skills update.

No DecimalAI package. The whole skill goes in every prompt, and nothing pins or updates it.

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

Give it to your agent

from pathlib import Path
from strands import Agent

skill = Path(".agents/skills/tooluniverse-molecular-cloning/SKILL.md").read_text()
agent = Agent(model=model, system_prompt=f"You are a helpful agent.\n\n{skill}")
agent("Hello!")

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Strands docs

Adds every file the skill has, pinned so you can update it. Cursor, Copilot, Cline and Warp read this folder by themselves.

pip install "decimalai>=0.15"
decimalai skills add tooluniverse-molecular-cloning

No Python or account. Cursor, Copilot, Cline and Warp read this folder by themselves.

Save it into your project

curl -fsSL --create-dirs -o .agents/skills/tooluniverse-molecular-cloning/SKILL.md https://app.decimal.ai/s/tooluniverse-molecular-cloning/SKILL.md

Copy SKILL.md

Save it in your project, as

.agents/skills/tooluniverse-molecular-cloning/SKILL.md

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Cursor and other editors docs

Fetch the file and give its text to your model as instructions. No account or package needed.

Get the file

curl -fsSL https://app.decimal.ai/s/tooluniverse-molecular-cloning/SKILL.md

Read the summary as JSON

curl -fsSL https://app.decimal.ai/s/tooluniverse-molecular-cloning.json

This gets SKILL.md only. The skill's 1 other file is not included.

Other ways to add it

Other setups docs

You don't need a DecimalAI account.

Version: v3 (v2 tested 8/9/2026)
Source: mims-harvard/ToolUniverse ↗
License: Apache-2.0

Manage it in DecimalAI

Saved prompts and skills, pinned versions, and traces of this skill in your runs. DecimalAI does not run your agent.

Claude Code reads files from your project, so DecimalAI config does not apply there.

On Claude Agent SDK: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On OpenAI Agents: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On OpenAI SDK: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On Anthropic: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On Gemini API: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On LangChain: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On CrewAI: set DECIMAL_API_KEY and add decimalai.init(crewai=True) to record runs and skill use. The skill version stays in your repo.

On Google ADK: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On Pydantic AI: save the skill to an agent here, set DECIMAL_API_KEY, and the same code uses it with no command to run. Changes you save reach the next run with no redeploy.

On Deep Agents: set DECIMAL_API_KEY and add decimalai.init(langchain=True) to record runs and skill use. The skill version stays in your repo.

On Microsoft Agent Framework: set DECIMAL_API_KEY and add decimalai.init(otel=True, agent_name="support") to record runs and skill use. The skill version stays in your repo.

On Strands: set DECIMAL_API_KEY and add decimalai.init(otel=True, agent_name="support") to record runs and skill use. The skill version stays in your repo.

Editors read files from your project, so DecimalAI config does not apply there.

Anywhere else: record a use with decimalai.log_skill_activation() inside a trace.

Use this skill

SKILL.md

Molecular Cloning Assembly Design (Gibson & Golden Gate)

Plan how to join DNA fragments into a construct: design the overlaps (Gibson) or Type IIS overhangs (Golden Gate) and avoid the failures that come from internal sites and non-unique junctions.

Step 0 — Pick the method

Use Gibson Assembly when	Use Golden Gate when
A few fragments, scarless/seamless junctions anywhere you choose	Many parts, standardized reusable parts (MoClo/modular), one-pot
You can add ~20–40 bp homology by PCR	You can remove internal BsaI/BbsI sites (domestication)
One-off constructs	Combinatorial libraries / repeated assemblies

Both are sequence-independent (no scar at the junction for Gibson; a 4-bp fusion scar for Golden Gate). For 2–4 unique fragments, Gibson is usually simplest; for libraries or a parts toolkit, Golden Gate.

Step 1 — Gibson Assembly

tu run DNA_gibson_design '{"operation":"gibson_design",
  "fragments":["ATGGCG...GAGGAC","GAGGAC...GGCAAG","GGGCAAG...ATCCT"],
  "overlap_length":20}'

For each fragment it returns left_overlap, right_overlap, and with_overlaps (the fragment extended with the homology arms you'd add to your PCR primers — hand these to tooluniverse-primer-design).

Gibson design rules

Overlap length 15–40 bp (20–25 typical); longer for GC-poor junctions.
Overlap Tm ≈ 48–65 °C and balanced between junctions.
Fragment order matters — list fragments in assembly order; the last fragment's 3′ overlaps the first only if you're making a circle (vector).
Avoid repeats/secondary structure at the junctions (hairpins, direct repeats) → misassembly.
Unique junctions — if two junctions share homology, fragments can swap; redesign so each overlap is unique.

Step 2 — Golden Gate Assembly

tu run DNA_golden_gate_design '{"operation":"golden_gate_design",
  "parts":["ATGGCG...AAGAAC","CTGAGC...CTGATC","GAGGAG...GTGGTG"],
  "enzyme":"BsaI"}'

Returns parts_with_overhangs: each part's unique 4-bp left_overhang/right_overhang and the full_sequence flanked by the Type IIS recognition sites (e.g. BsaI GGTCTC(N1) … cutting outside its site to leave the 4-bp fusion overhang).

Golden Gate design rules

Domestication is mandatory. The chosen enzyme's site (BsaI GGTCTC, BbsI GAAGAC) must NOT occur inside any part, or it will be cut internally. Remove internal sites by silent mutation before assembly — check every part. Don't rely on memorized recognition sites for a less common enzyme, or when a part's internal site can't be silently removed and you need an isoschizomer instead: REBASE_get_enzyme (site + methylation sensitivity) and REBASE_list_isoschizomers (alternative enzymes cutting the same site) are the authoritative lookup.
Overhangs must be unique and non-palindromic. Each 4-bp fusion site must differ from the others and not equal its own reverse complement, or junctions misligate. The tool assigns unique non-palindromic overhangs; keep them.
Avoid high-GC or all-AT overhangs; published high-fidelity overhang sets (e.g. Potapov 2018) ligate most cleanly.
Order is encoded by the overhangs, not by listing order — the 4-bp junctions define assembly.

Step 3 — QC before ordering

scripts/cloning_qc.py screens parts for the problems above: internal BsaI/BbsI sites (Golden Gate), overhang uniqueness/palindromes, and Gibson overlap GC/length — and flags PASS/WARN.

Step 4 — Gotchas (state these)

Internal Type IIS sites (Golden Gate) — the #1 failure; domesticate every part.
Non-unique Gibson overlaps or shared homology → fragment swapping / misassembly.
Repeats and strong secondary structure at junctions reduce efficiency in both methods.
Overlap Tm imbalance (Gibson) → some junctions form, others don't.
Generating the fragments still needs primers with the overlaps/overhangs appended — design and QC those in tooluniverse-primer-design (and BLAST for specificity).

Working backwards — what does an existing assembly produce?

The reverse question ("I combined these plasmids in a Golden Gate reaction with Esp3I — what does the product express / what does the gRNA target?") is answered by one call. Do not hand-write a digestion/ligation simulator.

tu run DNA_golden_gate_assemble '{"fragments":["<plasmid1>","<plasmid2>","<plasmid3>"],
    "enzyme":"Esp3I","labels":["pLAB-CTU","pLAB-gTU2E","pLAB-CH3"]}'

It digests each input, drops the fragments that keep a recognition site (those are re-cut in the reaction and cannot persist), chains the rest by matching 4-bp overhangs, and returns product_sequence, product_length and the assembly_order with the overhang at every junction. Inputs are treated as circular plasmids unless you pass circular: false.

Then annotate the product. Locate features in product_sequence (promoter, ORF, gRNA spacer). For a gRNA cassette the spacer is the ~20 nt immediately 5′ of the scaffold (GTTTTAGAGCTAGAAATAGCAAG); identify its target by matching that spacer against the genome (BLAST_*, or an Ensembl/NCBI/SGD sequence lookup) and check for an adjacent PAM. Match the species implied by the construct — yeast tRNA/Pol III parts mean search the yeast genome, not human.

If the assembly reports that the fragments do not chain, digest the inputs individually with DNA_virtual_digest (circular: true) to see what each released: a Golden Gate donor carries its two Type IIS sites inverted around the insert, so a correct digest gives 2 fragments per plasmid. Getting 1 means the enzyme name or circular is wrong — not that the plasmid lacks sites.

Enzyme names: Esp3I and BsmBI are the same enzyme (CGTCTC); BsaI (GGTCTC), BbsI (GAAGAC) and SapI (GCTCTTC) all resolve too.

Honest limitations

Digestion and overhang-driven ligation are simulated faithfully (DNA_virtual_digest and DNA_golden_gate_assemble cut both strands at each enzyme's real offset, including Type IIS enzymes that cut outside their site). What is not modelled is reaction efficiency — overhang ligation bias, partial digestion, incorrect-but-possible junctions — so a returned product is the intended assembly, not a yield prediction. Validate by sequencing the assembled construct.
No vector-backbone or ORF-frame checking — confirm reading frame and backbone compatibility yourself.

Related skills

tooluniverse-primer-design — design the PCR primers (with homology arms / Type IIS tails) to make the fragments.
tooluniverse-sequence-analysis — handle the input sequences.

When it activates

Only when you call it by name. Your agent never loads it on its own. Use when you need to plan how to join DNA fragments into a construct, design assembly overlaps/overhangs, or decide between cloning methods. Covers the domestication (internal-site removal), overhang-uniqueness, and overlap-Tm rules. For PCR primers to generate the fragments, see tooluniverse-primer-de

About this skill

On-demandOn-demand: invoked explicitly — never occupies your agent's context until called.

Research pack

SkillSafety

✓ 3 of 3 passed

Code scan15 of 15 checks clean

0 critical · 0 warning · 0 info — scanner v5 — 9/22/2026

View 15 scanner checks

live_secretremote_code_executionreverse_shelldata_exfiltrationssrf_metadataagent_snoopinganti_refusaldestructive_commandsobfuscated_unicodeunicode_homoglyphopaque_blobsuspicious_urltool_overreachtrigger_abuseprompt_injection_phrasing

IntentSafe

LLM judge · does the skill do what it claims

ContentClean

LLM judge · policy & harmful-content review

Source

Imported

mims-harvard / ToolUniverse

skills/tooluniverse-molecular-cloning/SKILL.md

View on GitHub ↗

License Apache-2.0Imported 9/22/2026Version v3Bundled 1 file · scripts

Illustrative Want to see what tooluniverse-molecular-cloning would put in front of your model? Preview the rendered body and check its trigger phrases — no LLM call, no signup.

Other skills for the same job

Published skills whose descriptions closely match this one, with their headline benchmark lift.

mims-harvard/tooluniverse-molecular-cloningMolecular cloning assembly design — Gibson Assembly (overlap design for seamless multi-fragment joining) and Golden Gate Assembly (Type IIS / BsaI / BbsI design with unique 4-bp fusion overhangs). Use when you need to plan how to join DNA fragments into a construct, design assembly overlaps/overhangs, or decide between cloning methods. Covers the domestication (internal-site removal), overhang-uniqueness, and overlap-Tm rules. For PCR primers to generate the fragments, see tooluniverse-primer-deNear-identical description+27 pts pass-rate lift

Related skills

Skills that do similar work, with their headline benchmark lift.

From the same source and nearby in the catalogue.

Ready to supercharge your AI agents?

SkillScore

Safety

What it changes

Track record

Use this skill

Molecular Cloning Assembly Design (Gibson & Golden Gate)

Step 0 — Pick the method

Step 1 — Gibson Assembly

Step 2 — Golden Gate Assembly

Step 3 — QC before ordering

Step 4 — Gotchas (state these)

Working backwards — what does an existing assembly produce?

Honest limitations

Related skills

When it activates

SkillSafety

Source

Other skills for the same job

Related skills

More in the registry